Back to top

Primer-Sonden-Sets für den Nachweis von SARS-CoV-2

Primer-Probe Sets for the Detection of  SARS-CoV-2
 
 
Um die Arbeit von Forschern, die sich mit dem neuen Coronavirus beschäftigen, zu beschleunigen, bietet Microsynth jetzt gebrauchsfertige Primer und Sonden für den Nachweis und die Identifizierung von SARS-CoV-2 an. Diese gebrauchsfertigen Primer und Sonden werden sofort zum Versand bereitgestellt und können bei Bedarf schnell nachgeliefert werden. Wir sind bestrebt, alle Projekte im Zusammenhang mit dem Coronavirus (SARS-CoV-2) so lange zu priorisieren, wie sie benötigt werden.
 
Nur für Forschungszwecke. Nicht zur Verwendung in diagnostischen Verfahren.
 

Features and Benefits

 
 
Schnell
  • Versand am selben Tag, wenn Sie bis 12 Uhr bestellen, sonst am nächsten Werktag
  • Per Expresspost kostenlos
 
Hohe Qualität
  • Herstellung in einer nach ISO 13485:2016 zertifizierten Produktionsstätte
  • Strenge QC einschließlich Real-Time-PCR-Funktionalitätstests (Positiv- und No-Template-Kontrolle mit Cp <40) vor der Chargenfreigabe
  • Oligos werden aus einer "sauberen" Anlage ausgeliefert, da wir keine Positivkontrollen synthetisieren
 
 
 
 
Praktisch
  • Primer-Sonden-Sets für 1'000 Reaktionen (mit gebrauchsfertiger Arbeitskonzentration nach Charité/Berlin Protokoll)
  • Abdeckung der meisten gängigen qPCR-Geräte (inkl. cobas®6800/8800 Systeme von Roche)
 
 
Von der WHO empfohlen
  • Primer- und Sondensequenzen mit den gleichen Farbstofftechnologien wie von der WHO empfohlen
  • Volle Transparenz bezüglich der Sequenzinformationen
 

Produkte

 
E_Sarbeco Primer-Probe Set
Artikel Nummer: 1600
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [EUR]
E_Sarbeco_F1 ACAGGTACGTTAATAGTTAATAGCGT   30 liquid 450.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA   30
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 10
 
Produkt Information:
 
 
E_Sarbeco Primer-Probe Set cobas®
Artikel Nummer: 1610
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [EUR]
E_Sarbeco_F1 ACAGGTACGT TA ATAGT TA ATAGCmGT   90 liquid 860.-
E_Sarbeco_R2 ATATTGCAGCAGTACGCACAmCA   90
E_Sarbeco_P1 ACACTAGCC/iQ500/ATCCTTACTGCGCTTCG 5'6-FAM, 3'BHQ1 15
 
Produkt Information:
 
RdRP_SARS Primer-Probe Set
Artikel Nummer: 1620
Name of Primers & Probes Sequences Modification Yield (nmol)1 Physical Condition Price [EUR]
RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG   30 liquid 640.-
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA   30
SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 5'6-FAM, 3'BHQ1 10
SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5'6-FAM, 3'BHQ1 10
 
Produkt Information:
 
 
1 Geeignet für minimal 1'000 PCR-Reaktionen (25 µl Volumen)

Wie bestellen

 
 
Geben Sie Ihre Bestellung auf, indem Sie eine E-Mail an info@microsynth.ch schreiben und die folgenden Punkte angeben:
  • Gewünschte Artikelnummer
  • Gewünschte Anzahl von Primer-Sonden-Sets
  • Ihre Liefer- und Rechnungsadresse
 
Wichtiger Hinweis:
Wir nehmen derzeit keine Bestellungen für synthetische Oligonukleotid-Positivkontrollen an, die sich auf eine SARS-Coronavirus-Sequenz beziehen.
Sollten Sie eine Positivkontrolle benötigen, bitten wir Sie, sich an folgende Quelle zu wenden: https://www.european-virus-archive.com/